{"181930":{"id":"181930","parent":"176874","time":"1605950278","url":"http:\/\/reseauinternational.net\/covid-19-preuves-de-fraude-mondiale\/","category":"documentaires","title":"Covid-19 - Preuves de fraude mondiale","lead_image_url":"http:\/\/newsnet.fr\/img\/newsnet_181930_68212f.jpg","hub":"newsnet","url-explicit":"covid-19-preuves-de-fraude-mondiale","admin":"newsnet","views":"137","priority":"3","length":"31832","lang":"","content":"\u003Cp\u003E\u003Cb\u003Epar Iain Davis.\u003C\/b\u003E\u003C\/p\u003E\u003Cp\u003ELa COVID-19, et les r\u00e9ponses gouvernementales subs\u00e9quentes, semblent faire partie d'une conspiration internationale visant \u00e0 commettre des fraudes. Il semble qu'il n'y ait aucune preuve qu'un virus appel\u00e9 SRAS-CoV-2 provoque une maladie appel\u00e9e COVID-19.\u003C\/p\u003E\u003Cp\u003EParfois, il faut suivre son instinct. Je ne suis pas un expert en g\u00e9n\u00e9tique et, comme toujours, je suis susceptible d'\u00eatre corrig\u00e9. Toutefois, mon attention a \u00e9t\u00e9 attir\u00e9e par certaines recherches publi\u00e9es par la revue m\u00e9dicale espagnole \u003Ci\u003ED-Salud-Discovery\u003C\/i\u003E. \u003Ca href=\"https:\/\/www.dsalud.com\/consejo-asesor\"\u003ELeur conseil consultatif\u003C\/a\u003E compos\u00e9 de m\u00e9decins et de scientifiques \u00e9minemment qualifi\u00e9s conf\u00e8re une cr\u00e9dibilit\u00e9 suppl\u00e9mentaire \u00e0 leurs recherches. Leur affirmation est stup\u00e9fiante.\u003C\/p\u003E\u003Cp\u003ELes amorces et les sondes g\u00e9n\u00e9tiques utilis\u00e9es dans les tests RT-PCR pour identifier le SRAS-CoV-2 ne ciblent rien de sp\u00e9cifique. J'ai suivi les techniques de recherche d\u00e9crites dans cette \u003Ca href=\"http:\/\/philosophers-stone.info\/wp-content\/uploads\/2020\/11\/The-scam-has-been-confirmed-Dsalud-November-2020.pdf\" target=\"_blank\"\u003Etraduction anglaise\u003C\/a\u003E de leur rapport et je peux corroborer l'exactitude de leurs affirmations concernant les s\u00e9quences de nucl\u00e9otides \u00e9num\u00e9r\u00e9es dans les protocoles de l'Organisation Mondiale de la Sant\u00e9. Vous pouvez faire de m\u00eame.\u003C\/p\u003E\u003Cp\u003E\u003Ci\u003ED-Salud-Discovery\u003C\/i\u003E d\u00e9clare qu'il n'existe pas de tests capables d'identifier le SRAS-CoV-2. Par cons\u00e9quent, toutes les all\u00e9gations concernant l'impact pr\u00e9sum\u00e9 de la COVID-19 sur la sant\u00e9 de la population sont sans fondement.\u003C\/p\u003E\u003Cp\u003EL'ensemble du r\u00e9cit officiel de la COVID-19 est une tromperie. Apparemment, il n'y a aucun fondement scientifique pour aucune partie de ce r\u00e9cit.\u003C\/p\u003E\u003Cp\u003ESi ces affirmations sont exactes, nous pouvons affirmer qu'il n'y a aucune preuve de pand\u00e9mie, mais seulement l'illusion d'une pand\u00e9mie. Nous avons subi des pertes incalculables sans raison \u00e9vidente, si ce n'est les ambitions de despotes sans scrupules qui souhaitent transformer l'\u00e9conomie mondiale et notre soci\u00e9t\u00e9 pour r\u00e9pondre \u00e0 leurs objectifs.\u003C\/p\u003E\u003Cp\u003ECe faisant, cette \u00ab classe de parasites \u00bb a potentiellement commis d'innombrables crimes. Ces crimes peuvent et doivent faire l'objet d'une enqu\u00eate et de poursuites devant un tribunal.\u003C\/p\u003E\u003Cimg src=\"http:\/\/newsnet.fr\/\/img\/newsnet_181930_68212f.jpg\" \/\u003E\u003Cp\u003E\u003Cb\u003EIdentification de quoi exactement ?\u003C\/b\u003E\u003C\/p\u003E\u003Cp\u003EL'Organisation Mondiale de la Sant\u00e9 (OMS) a \u003Ca href=\"https:\/\/web.archive.org\/web\/20200915102012if_\/https:\/\/www.who.int\/health-topics\/coronavirus#tab=tab_1\"\u003Eclassifi\u00e9 la maladie COVID-19\u003C\/a\u003E (COronaVIrus Disease 2019). Elle a d\u00e9clar\u00e9 une pand\u00e9mie mondiale de COVID-19 le 11 mars 2019.\u003C\/p\u003E\u003Cimg src=\"http:\/\/newsnet.fr\/\/img\/newsnet_181930_08553d.jpg\" \/\u003E\u003Cp\u003ELe \u003Ca href=\"https:\/\/in-this-together.com\/Wdh4hd\/WHOLabGuidance.pdf?x56485\" target=\"_blank\"\u003Eguide de l'OMS sur les essais en laboratoire\u003C\/a\u003E stipule ce qui suit :\u003C\/p\u003E\u003Cp\u003E\u00ab L'agent \u00e9tiologique [causalit\u00e9 de la maladie] responsable de l'ensemble des cas de pneumonie \u00e0 Wuhan a \u00e9t\u00e9 identifi\u00e9 comme un nouveau betacoronavirus (de la m\u00eame famille que le SRAS-CoV et le MERS-CoV) par s\u00e9quen\u00e7age de nouvelle g\u00e9n\u00e9ration (NGS) \u00e0 partir de virus cultiv\u00e9s ou directement \u00e0 partir d'\u00e9chantillons re\u00e7us de plusieurs patients atteints de pneumonie \u00bb.\u003C\/p\u003E\u003Cp\u003EL'OMS affirme que le virus SRAS-CoV-2 est \u00e0 l'origine de la maladie appel\u00e9e COVID-19. Ils affirment \u00e9galement que ce virus a \u00e9t\u00e9 clairement identifi\u00e9 par des chercheurs de Wuhan.\u003C\/p\u003E\u003Cp\u003EDans le rapport de l'OMS intitul\u00e9 \u00ab \u003Ca href=\"https:\/\/apps.who.int\/iris\/bitstream\/handle\/10665\/330760\/nCoVsitrep21Jan2020-eng.pdf?sequence=3&isAllowed=y\" target=\"_blank\"\u003ENouveau Coronavirus 2019-nCov Rapport de Situation 1\u003C\/a\u003E \u00bb, ils affirment :\u003C\/p\u003E\u003Cp\u003E\u00ab Les autorit\u00e9s chinoises ont identifi\u00e9 un nouveau type de coronavirus, qui a \u00e9t\u00e9 isol\u00e9 le 7 janvier 2020... Le 12 janvier 2020, la Chine a partag\u00e9 la s\u00e9quence g\u00e9n\u00e9tique du nouveau coronavirus pour que les pays puissent l'utiliser dans le d\u00e9veloppement de kits de diagnostic sp\u00e9cifiques \u00bb.\u003C\/p\u003E\u003Cp\u003ECes deux d\u00e9clarations de l'OMS sugg\u00e8rent clairement que le virus SRAS-CoV-2 a \u00e9t\u00e9 isol\u00e9 (c'est-\u00e0-dire purifi\u00e9 pour \u00eatre \u00e9tudi\u00e9) et que des s\u00e9quences g\u00e9n\u00e9tiques ont ensuite \u00e9t\u00e9 identifi\u00e9es \u00e0 partir de l'\u00e9chantillon isol\u00e9. \u00c0 partir de l\u00e0, des kits de diagnostic ont \u00e9t\u00e9 mis au point et distribu\u00e9s dans le monde entier pour tester le virus dans les villes et les communaut\u00e9s du monde entier. Selon l'OMS et les chercheurs chinois, ces tests permettront de trouver le virus qui cause la COVID-19.\u003C\/p\u003E\u003Cp\u003EPourtant, l'OMS d\u00e9clare \u00e9galement :\u003C\/p\u003E\u003Cp\u003E\u00ab Travaillant directement \u00e0 partir des informations sur les s\u00e9quences, l'\u00e9quipe a mis au point une s\u00e9rie de tests d'amplification g\u00e9n\u00e9tique (PCR) utilis\u00e9s par les laboratoires \u00bb.\u003C\/p\u003E\u003Cp\u003ELes scientifiques de Wuhan ont d\u00e9velopp\u00e9 leurs tests d'amplification g\u00e9n\u00e9tique \u00e0 partir des \u00ab informations sur les s\u00e9quences \u00bb parce qu'il n'y avait pas d'\u00e9chantillon isol\u00e9 et purifi\u00e9 du fameux virus SRAS-CoV-2. Ils ont \u00e9galement montr\u00e9 des images au microscope \u00e9lectronique des virions nouvellement d\u00e9couverts (la boule de prot\u00e9ines avec des pics contenant l'ARN viral).\u003C\/p\u003E\u003Cp\u003EToutefois, ces structures prot\u00e9iques ne sont \u003Ca href=\"https:\/\/kidney360.asnjournals.org\/content\/1\/8\/824\"\u003Epas uniques\u003C\/a\u003E. Elles ressemblent \u00e0 d'autres v\u00e9sicules rondes, telles que les v\u00e9sicules endocytiques et les exosomes.\u003C\/p\u003E\u003Cimg src=\"http:\/\/newsnet.fr\/\/img\/newsnet_181930_e8caef.jpg\" \/\u003E\u003Cp\u003ELes virologistes affirment qu'il n'est pas possible \u00ab d'isoler \u00bb un virus parce qu'il ne se r\u00e9plique qu'\u00e0 l'int\u00e9rieur des cellules h\u00f4tes. Ils ajoutent que les \u003Ca href=\"https:\/\/www.medicinenet.com\/kochs_postulates\/definition.htm\"\u003Epostulats de Koch\u003C\/a\u003E ne s'appliquent pas parce qu'ils concernent les bact\u00e9ries (qui sont des organismes vivants). Les virologistes observent plut\u00f4t les effets cytopathog\u00e8nes (ECP) du virus, qui provoquent la mutation et la d\u00e9gradation des cellules, dans des cultures cellulaires.\u003C\/p\u003E\u003Cp\u003ELorsque les chercheurs chinois ont \u003Ca href=\"https:\/\/www.nature.com\/articles\/s41586-020-2012-7\"\u003Es\u00e9quenc\u00e9 le g\u00e9nome\u003C\/a\u003E complet du SRAS-CoV-2 pour la premi\u00e8re fois, ils ont observ\u00e9 des ECP dans les cellules Vero E6 et Huh7. Les Vero E6 sont une lign\u00e9e cellulaire immortalis\u00e9e de singe et les Huh7 sont des cellules canc\u00e9reuses (tumorig\u00e8nes) immortalis\u00e9es. Cela signifie qu'elles ont \u00e9t\u00e9 maintenues in vitro (dans des cultures en bo\u00eete de P\u00e9tri) pendant de nombreuses ann\u00e9es.\u003C\/p\u003E\u003Cp\u003EAu cœur de l'histoire officielle du SRAS-CoV-2 se trouve l'id\u00e9e qu'il s'agit d'un virus zoonotique, capable de passer de l'animal \u00e0 l'homme. Lorsque les \u003Ca href=\"https:\/\/www.biorxiv.org\/content\/10.1101\/2020.03.02.972935v1.full.pdf\" target=\"_blank\"\u003Escientifiques du CDC\u003C\/a\u003E am\u00e9ricain ont \u00ab infect\u00e9 \u00bb diverses cellules avec le nouveau virus, ils ont constat\u00e9 ce qui suit :\u003C\/p\u003E\u003Cp\u003E\u00ab Nous avons examin\u00e9 la capacit\u00e9 du SRAS-CoV-2 \u00e0 infecter et \u00e0 se r\u00e9pliquer dans plusieurs lign\u00e9es cellulaires communes de primates et d'humains, notamment les cellules d'ad\u00e9nocarcinome humain (A549) [celles des poumons], les cellules de foie humain (HUH7. 0) et des cellules r\u00e9nales embryonnaires humaines (HEK-293T), en plus des cellules Vero E6 et Vero CCL81 [cellules de singe]... Aucun effet cytopathique n'a \u00e9t\u00e9 observ\u00e9 dans aucune des lign\u00e9es cellulaires, sauf dans les cellules Vero [cellules de singe]... Les cellules HUH7.0 et 293T n'ont montr\u00e9 qu'une r\u00e9plication virale modeste et les cellules A549 [cellules de tissu pulmonaire humain] \u00e9taient incompatibles avec l'infection par le SRAS-CoV-2 \u00bb.\u003C\/p\u003E\u003Cp\u003ELe CDC n'a observ\u00e9 aucun ECP dans les cellules humaines. Ils n'ont vu aucune preuve que ce pr\u00e9tendu virus ait caus\u00e9 une quelconque maladie humaine. Ce suppos\u00e9 virus humain n'a pas non plus montr\u00e9 de r\u00e9plication notable dans les cellules humaines, ce qui sugg\u00e8re qu'une infection d'homme \u00e0 homme serait impossible.\u003C\/p\u003E\u003Cp\u003EConstatant ce probl\u00e8me, une \u00e9quipe de scientifiques polonais a introduit ce \u00ab virus \u00bb s\u00e9quenc\u00e9 dans des \u003Ca href=\"https:\/\/www.biorxiv.org\/content\/10.1101\/2020.03.20.999029v1.full.pdf\" target=\"_blank\"\u003Ecellules d'\u00e9pith\u00e9lium humain\u003C\/a\u003E (voies a\u00e9riennes). Ils ont observ\u00e9 les effets sur ces cultures d'\u00e9pith\u00e9lium humain pendant 5 jours. Ils ont not\u00e9 une r\u00e9plication beaucoup plus importante que les scientifiques du CDC, mais ont finalement d\u00e9clar\u00e9 :\u003C\/p\u003E\u003Cp\u003E\u00ab Nous n'avons observ\u00e9 aucune lib\u00e9ration du virus du c\u00f4t\u00e9 basolat\u00e9ral de la culture d'\u00e9pith\u00e9lium humain \u00bb.\u003C\/p\u003E\u003Cp\u003ECe qui signifie qu'ils n'ont vu aucune preuve que les virions suppos\u00e9s aient rompu la membrane de la paroi cellulaire. Ce qui sugg\u00e8re \u00e0 nouveau que ce soi-disant virus n'est pas infectieux chez les \u00eatres humains.\u003C\/p\u003E\u003Cp\u003EIl n'est pas certain que le SRAS-CoV-2 soit un virus humain capable de provoquer une maladie. Il se peut m\u00eame qu'il n'existe pas physiquement. N'est-ce rien d'autre qu'un concept bas\u00e9 sur des s\u00e9quences g\u00e9n\u00e9tiques pr\u00e9dictives ?\u003C\/p\u003E\u003Cimg src=\"http:\/\/newsnet.fr\/\/img\/newsnet_181930_023c6f.jpg\" \/\u003E\u003Cp\u003E\u003Cb\u003EVoyage de Discovery\u003C\/b\u003E\u003C\/p\u003E\u003Cp\u003ELe Centre de Contr\u00f4le et de Pr\u00e9vention des Maladies de Wuhan et le Centre Clinique de Sant\u00e9 Publique de Shanghai ont publi\u00e9 le \u003Ca href=\"https:\/\/www.ncbi.nlm.nih.gov\/nuccore\/MN908947.1\"\u003Epremier g\u00e9nome complet\u003C\/a\u003E du SRAS-CoV-2 (MN908947.1). Celui-ci a \u00e9t\u00e9 mis \u00e0 jour \u00e0 de nombreuses reprises. Cependant, MN908947.1 a \u00e9t\u00e9 la premi\u00e8re s\u00e9quence g\u00e9n\u00e9tique d\u00e9crivant le pr\u00e9tendu agent \u00e9tiologique de la COVID-19 (SARS-CoV-2).\u003C\/p\u003E\u003Cp\u003EToutes les revendications, tests, traitements, statistiques, d\u00e9veloppement de vaccins et politiques qui en d\u00e9coulent sont bas\u00e9s sur cette s\u00e9quence. Si les tests de ce nouveau virus n'identifient rien qui puisse causer une maladie chez les \u00eatres humains, tout le r\u00e9cit de la COVID-19 n'est qu'une mascarade.\u003C\/p\u003E\u003Cp\u003ELes chercheurs de Wuhan ont \u003Ca href=\"https:\/\/www.nature.com\/articles\/s41586-020-2012-7\"\u003Ed\u00e9clar\u00e9\u003C\/a\u003E qu'ils avaient efficacement reconstitu\u00e9 la s\u00e9quence g\u00e9n\u00e9tique du SRAS-CoV-2 en faisant correspondre des fragments trouv\u00e9s dans des \u00e9chantillons avec d'autres s\u00e9quences g\u00e9n\u00e9tiques d\u00e9couvertes pr\u00e9c\u00e9demment. \u00c0 partir du mat\u00e9riel recueilli, ils ont trouv\u00e9 une correspondance de 87,1% avec le coronavirus du SRAS (SARS-Cov). Ils ont utilis\u00e9 \u003Ca href=\"https:\/\/thesequencingcenter.com\/knowledge-base\/de-novo-assembly\"\u003El'assemblage de novo\u003C\/a\u003E et le PCR cibl\u00e9 et ont trouv\u00e9 29 891 paires de bases qui partageaient une s\u00e9quence correspondant \u00e0 79,6% au SRAS-CoV.\u003C\/p\u003E\u003Cp\u003EIls ont d\u00fb utiliser l'assemblage de novo parce qu'ils n'avaient aucune connaissance a priori de la s\u00e9quence ou de l'ordre corrects de ces fragments. Tout simplement, la d\u00e9claration de l'OMS selon laquelle les chercheurs chinois ont isol\u00e9 le virus le 7 janvier est fausse.\u003C\/p\u003E\u003Cp\u003EL'\u00e9quipe de Wuhan a utilis\u00e9 40 cycles d'amplification RT-qPCR pour faire correspondre des fragments d'ADNc (ADN compl\u00e9mentaire construit \u00e0 partir de fragments d'ARN \u00e9chantillonn\u00e9s) avec le g\u00e9nome publi\u00e9 du coronavirus du SRAS (SARS-CoV). Malheureusement, la pr\u00e9cision du g\u00e9nome original du coronavirus du SRAS n'est pas claire non plus.\u003C\/p\u003E\u003Cp\u003EEn 2003, une \u00e9quipe de \u003Ca href=\"https:\/\/www.thelancet.com\/journals\/lancet\/article\/PIIS0140-6736(03)13077-2\/fulltext\"\u003Echercheurs de Hong Kong\u003C\/a\u003E a \u00e9tudi\u00e9 50 patients atteints du Syndrome Respiratoire Aigu S\u00e9v\u00e8re (SRAS). Ils ont pr\u00e9lev\u00e9 des \u00e9chantillons sur 2 de ces patients et ont d\u00e9velopp\u00e9 une culture dans des cellules de foie de singe fœtal.\u003C\/p\u003E\u003Cp\u003EIls ont cr\u00e9\u00e9 30 clones du mat\u00e9riel g\u00e9n\u00e9tique qu'ils ont trouv\u00e9. Incapables de trouver des preuves d'un autre virus connu, ils ont trouv\u00e9 dans un seul de ces \u00e9chantillons clon\u00e9s des s\u00e9quences g\u00e9n\u00e9tiques \u00ab d'origine inconnue \u00bb.\u003C\/p\u003E\u003Cimg src=\"http:\/\/newsnet.fr\/\/img\/newsnet_181930_ba75b3.jpg\" \/\u003E\u003Cp\u003EEn examinant ces s\u00e9quences d'ARN inconnues, ils ont trouv\u00e9 57% de correspondance avec le coronavirus bovin et le virus de l'h\u00e9patite murine et en ont d\u00e9duit qu'il \u00e9tait de la famille des Coronaviridae. Consid\u00e9rant que ces s\u00e9quences sugg\u00e8rent un virus du SRAS-CoV r\u00e9cemment d\u00e9couvert (les nouvelles d\u00e9couvertes \u00e9tant l'ambroisie pour les scientifiques), ils ont con\u00e7u des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont d\u00e9clar\u00e9 :\u003C\/p\u003E\u003Cp\u003E\u00ab Les amorces pour la d\u00e9tection du nouveau virus ont \u00e9t\u00e9 con\u00e7ues pour la d\u00e9tection par RT-PCR du g\u00e9nome de ce coronavirus associ\u00e9 \u00e0 la pneumonie humaine dans des \u00e9chantillons cliniques. Sur les 44 \u00e9chantillons nasopharyng\u00e9s disponibles provenant des 50 patients atteints du SRAS, 22 pr\u00e9sentaient des traces d'ARN de coronavirus humain associ\u00e9 \u00e0 la pneumonie \u00bb.\u003C\/p\u003E\u003Cp\u003ELa moiti\u00e9 des patients test\u00e9s, qui pr\u00e9sentaient tous les m\u00eames sympt\u00f4mes, se sont r\u00e9v\u00e9l\u00e9s positifs pour ce nouveau virus pr\u00e9sum\u00e9. Personne ne sait pourquoi l'autre moiti\u00e9 a \u00e9t\u00e9 test\u00e9e n\u00e9gative pour ce nouveau virus du SRAS-CoV. La question n'a pas \u00e9t\u00e9 pos\u00e9e.\u003C\/p\u003E\u003Cp\u003ECe pr\u00e9tendu virus n'avait qu'une s\u00e9quence correspondant \u00e0 57% \u00e0 un coronavirus pr\u00e9tendument connu. Les 43% restants \u00e9taient juste \u00ab l\u00e0 \u00bb. Les donn\u00e9es s\u00e9quenc\u00e9es ont \u00e9t\u00e9 produites et enregistr\u00e9es comme un nouveau g\u00e9nome sous le num\u00e9ro d'accession \u00e0 la GenBank \u003Ca href=\"https:\/\/science.sciencemag.org\/content\/sci\/300\/5624\/1399.full.pdf\" target=\"_blank\"\u003EAY274119\u003C\/a\u003E.\u003C\/p\u003E\u003Cp\u003ELes chercheurs de Wuhan ont ensuite trouv\u00e9 une correspondance de s\u00e9quence de 79,6% avec AY274119 et l'ont donc appel\u00e9e une nouvelle souche de SRAS-CoV (2019-nCoV - finalement rebaptis\u00e9e SARS-CoV-2). \u00c0 aucun moment de ce processus, personne n'avait produit d'\u00e9chantillon isol\u00e9 et purifi\u00e9 d'un quelconque virus. Tout ce qu'ils avaient, c'\u00e9tait des pourcentages de concordance de s\u00e9quences avec d'autres pourcentages de concordance de s\u00e9quences.\u003C\/p\u003E\u003Cp\u003E\u003Cb\u003EIsoler rien\u003C\/b\u003E\u003C\/p\u003E\u003Cp\u003ELes scientifiques sont tr\u00e8s ennuy\u00e9s parce qu'ils n'arr\u00eatent pas de dire que le virus a \u00e9t\u00e9 isol\u00e9 mais que personne ne les croit. C'est parce que, jusqu'\u00e0 pr\u00e9sent, personne n'a fourni un seul \u00e9chantillon purifi\u00e9 du virus SRAS-CoV-2. Ce que nous avons \u00e0 la place, c'est un g\u00e9nome complet et, comme nous sommes sur le point de le d\u00e9couvrir, ce n'est pas particuli\u00e8rement convaincant.\u003C\/p\u003E\u003Cp\u003ELes journalistes d'investigation Torsten Engelbrecht et Konstantin Demeter ont demand\u00e9 \u00e0 certains des scientifiques qui ont d\u00e9clar\u00e9 avoir des images des virions du SRAS-CoV-2 de confirmer qu'il s'agissait bien d'images d'un virus isol\u00e9 et purifi\u00e9. \u003Ca href=\"https:\/\/off-guardian.org\/2020\/06\/27\/covid19-pcr-tests-are-scientifically-meaningless\"\u003EAucun d'entre eux n'a pu le faire\u003C\/a\u003E.\u003C\/p\u003E\u003Cp\u003EEn Australie, des scientifiques de \u003Ca href=\"https:\/\/www.doherty.edu.au\/people\"\u003El'Institut Doherty\u003C\/a\u003E ont annonc\u00e9 qu'ils avaient \u003Ca onclick=\"SaveJ('popup_app__3_twit_call_1222345640769777671_tweet');\" class=\"txtx\"\u003E\u003Cspan class=\"philum ic-tw\" style=\"font-size:16px;\"\u003E\u003C\/span\u003E isol\u00e9 le virus SRAS-CoV-2\u003C\/a\u003E. Lorsqu'on leur a demand\u00e9 de pr\u00e9ciser, les scientifiques ont d\u00e9clar\u00e9 :\u003C\/p\u003E\u003Cp\u003E\u00ab Nous avons de courtes s\u00e9quences (ARN) provenant du test de diagnostic qui peuvent \u00eatre utilis\u00e9es dans les tests de diagnostic \u00bb.\u003C\/p\u003E\u003Cp\u003ECela explique pourquoi le \u003Ca href=\"https:\/\/www.tga.gov.au\/covid-19-testing-australia-information-health-professionals\"\u003Egouvernement australien\u003C\/a\u003E d\u00e9clare :\u003C\/p\u003E\u003Cp\u003E\u00ab La fiabilit\u00e9 des tests de la COVID-19 est incertaine en raison du peu de preuves disponibles... Il existe peu de preuves pour \u00e9valuer la pr\u00e9cision et l'utilit\u00e9 clinique des tests de la COVID-19 disponibles \u00bb.\u003C\/p\u003E\u003Cp\u003EAu Royaume-Uni, en juillet, un groupe d'universitaires inquiets a \u003Ca href=\"https:\/\/www.resetourplanet.com\/covid19-something-real-or-fake-what-do-we-know\"\u003E\u00e9crit une lettre\u003C\/a\u003E au Premier Ministre britannique Boris Johnson dans laquelle ils lui demandent de :\u003C\/p\u003E\u003Cp\u003E\u00ab Produire des preuves scientifiques ind\u00e9pendantes, examin\u00e9es par des pairs, prouvant que le virus de la COVID-19 a \u00e9t\u00e9 isol\u00e9 \u00bb.\u003C\/p\u003E\u003Cp\u003E\u00c0 ce jour, ils n'ont pas re\u00e7u de r\u00e9ponse.\u003C\/p\u003E\u003Cp\u003EDe m\u00eame, le chercheur britannique \u003Ca href=\"https:\/\/cvpandemicinvestigation.com\/2020\/09\/covid-19-evidence-of-fraud-medical-malpractice-acts-of-domestic-terrorism-and-breaches-of-human-rights\"\u003EAndrew Johnson\u003C\/a\u003E a adress\u00e9 une requ\u00eate en vertu de la Libert\u00e9 d'Information \u00e0 Public Health England (PHE). Il leur a demand\u00e9 de lui fournir leurs dossiers d\u00e9crivant l'isolement d'un virus SRAS-COV-2. Ce \u00e0 quoi ils ont \u003Ca href=\"https:\/\/www.whatdotheyknow.com\/request\/679566\/response\/1625332\/attach\/html\/2\/872%20FOI%20All%20records%20describing%20isolation%20of%20SARS%20COV%202.pdf.html\" target=\"_blank\"\u003Er\u00e9pondu\u003C\/a\u003E :\u003C\/p\u003E\u003Cp\u003E\u00ab PHE peut confirmer qu'il ne d\u00e9tient pas d'informations de la mani\u00e8re sugg\u00e9r\u00e9e par votre demande \u00bb.\u003C\/p\u003E\u003Cp\u003ELa chercheuse canadienne Christine Massey a fait une demande d'acc\u00e8s \u00e0 l'information similaire, demandant la m\u00eame chose au gouvernement canadien. Ce \u00e0 quoi le \u003Ca href=\"https:\/\/www.fluoridefreepeel.ca\/wp-content\/uploads\/2020\/06\/Health-Canada-FinalResponse-A-2020-00208-2020-06-13.pdf\" target=\"_blank\"\u003Egouvernement canadien a r\u00e9pondu\u003C\/a\u003E :\u003C\/p\u003E\u003Cp\u003E\u00ab Apr\u00e8s avoir effectu\u00e9 une recherche approfondie, nous avons le regret de vous informer que nous n'avons pu trouver aucun document r\u00e9pondant \u00e0 votre demande \u00bb.\u003C\/p\u003E\u003Cp\u003EAux \u00c9tats-Unis, le \u003Ca href=\"https:\/\/www.fda.gov\/media\/134922\/download\"\u003Epanel de diagnostic RT-PCR\u003C\/a\u003E du CDC indique :\u003C\/p\u003E\u003Cp\u003E\u00ab... Aucun isolat quantifi\u00e9 du virus 2019-nCoV n'est actuellement disponible... La d\u00e9tection de l'ARN viral peut ne pas indiquer la pr\u00e9sence d'un virus infectieux ou que le 2019-nCoV est l'agent responsable des sympt\u00f4mes cliniques \u00bb.\u003C\/p\u003E\u003Cp\u003EDerni\u00e8re mise \u00e0 jour le 13 juillet 2020, les CDC n'ont pas encore obtenu d'\u00e9chantillon viral pur d'un patient dit atteint de la maladie de la COVID-19. Ils admettent ouvertement que leurs tests ne montrent pas n\u00e9cessairement si le SRAS-CoV-2 est pr\u00e9sent ou cause la COVID-19.\u003C\/p\u003E\u003Cp\u003EOn nous dit que rien de tout cela n'a d'importance. Que nous sommes ignorants et que nous ne comprenons tout simplement pas la virologie. Par cons\u00e9quent, nous devons accepter des images de choses dont nous savons qu'elles pourraient \u00eatre autre chose et des s\u00e9quences g\u00e9n\u00e9tiques (qui pourraient \u00eatre n'importe quoi d'autre) comme preuve concluante que ce virus, et la maladie qu'il est cens\u00e9 causer, sont r\u00e9els.\u003C\/p\u003E\u003Cimg src=\"http:\/\/newsnet.fr\/\/img\/newsnet_181930_51ede4.jpg\" \/\u003E\u003Cp\u003E\u003Cb\u003EDes tests pour rien\u003C\/b\u003E\u003C\/p\u003E\u003Cp\u003EL'OMS, ainsi que tous les gouvernements, les groupes de r\u00e9flexion, les comit\u00e9s directeurs, les conseillers scientifiques gouvernementaux, les institutions supranationales et autres qui font la promotion de l'expos\u00e9 officiel de la COVID-19, affirment que le SRAS-CoV-2 provoque la COVID-19.\u003C\/p\u003E\u003Cp\u003EAlors que personne n'a jamais produit d'\u00e9chantillon de ce suppos\u00e9 virus, le pr\u00e9tendu g\u00e9nome du SRAS-CoV-2 a \u003Ca href=\"https:\/\/www.ncbi.nlm.nih.gov\/nuccore\/NC_045512.2?report=genbank&to=29903\"\u003E\u00e9t\u00e9 publi\u00e9\u003C\/a\u003E. Il est dans le domaine public.\u003C\/p\u003E\u003Cp\u003EDes \u003Ca href=\"https:\/\/www.genetex.com\/MarketingMaterial\/Index\/SARS-CoV-2_Genome_and_Proteome\"\u003Es\u00e9quences g\u00e9n\u00e9tiques\u003C\/a\u003E cl\u00e9s, dans le g\u00e9nome du SRAS-CoV-2, auraient des fonctions sp\u00e9cifiques. Ce sont les prot\u00e9ines cibles que les scientifiques testent pour identifier la pr\u00e9sence du \u00ab virus \u00bb. Il s'agit notamment de :\u003C\/p\u003E\u003Cp\u003E\u003Cul\u003E\u003Cli\u003ELe g\u00e8ne de l'ARN-polym\u00e9rase (Rd-Rp) - Il permet \u00e0 l'ARN du SRAS-CoV-2 de se r\u00e9pliquer dans le cytoplasme des cellules \u00e9pith\u00e9liales malades de la COVID-19.\u003C\/li\u003E\u003Cli\u003ELe g\u00e8ne S (Orf2) - cette glycoprot\u00e9ine forme le pic \u00e0 la surface du virion du SRAS-CoV-2 qui est cens\u00e9 faciliter la liaison du SRAS-CoV-2 aux r\u00e9cepteurs ACE2 des cellules, permettant \u00e0 l'ARN situ\u00e9 \u00e0 l'int\u00e9rieur de l'enveloppe prot\u00e9ique du virion (capside) de passer dans la cellule d\u00e9sormais infect\u00e9e.\u003C\/li\u003E\u003Cli\u003ELe G\u00e8ne E (Orf1ab) - petite prot\u00e9ine membranaire utilis\u00e9e dans l'assemblage du virus.\u003C\/li\u003E\u003Cli\u003ELe G\u00e8ne N (Orf9a) - le g\u00e8ne de la nucl\u00e9ocapside qui se lie \u00e0 l'ARN lors de la formation de la capside.\u003C\/li\u003E\u003C\/ul\u003E\u003C\/p\u003E\u003Cp\u003EL'OMS tient un \u003Ca href=\"https:\/\/web.archive.org\/web\/20201101102028\/https:\/\/www.who.int\/docs\/default-source\/coronaviruse\/whoinhouseassays.pdf?sfvrsn=de3a76aa_2&download=true\" target=\"_blank\"\u003Eregistre public\u003C\/a\u003E des amorces et des sondes RT-PCR utilis\u00e9es pour tester le SRAS-CoV-2. Les amorces sont des s\u00e9quences de nucl\u00e9otides sp\u00e9cifiques qui se lient (s'annulent) aux brins antisens et sensoriels de l'ADNc synth\u00e9tis\u00e9 (appel\u00e9es respectivement amorces avant et arri\u00e8re).\u003C\/p\u003E\u003Cp\u003ELes brins d'ADNc se s\u00e9parent lorsqu'ils sont chauff\u00e9s et se reforment lorsqu'ils sont refroidis. Avant le refroidissement, des s\u00e9quences de nucl\u00e9otides appel\u00e9es sondes sont introduites pour s'hybrider \u00e0 des r\u00e9gions cibles sp\u00e9cifiques du g\u00e9nome viral suspect\u00e9. Au cours de l'amplification, lorsque les r\u00e9gions entre les amorces s'allongent, lorsqu'une amorce frappe une sonde, celle-ci se d\u00e9sint\u00e8gre en lib\u00e9rant un fluorescent ou un colorant qui peut alors \u00eatre lu par les chercheurs.\u003C\/p\u003E\u003Cp\u003EC'est l'identification de ces marqueurs que les scientifiques pr\u00e9tendent prouver la pr\u00e9sence du SRAS-CoV-2 dans un \u00e9chantillon.\u003C\/p\u003E\u003Cp\u003EUn autre outil accessible au public est le \u003Ca href=\"https:\/\/blast.ncbi.nlm.nih.gov\/Blast.cgi\"\u003EBasic Local Alignment Search Tool\u003C\/a\u003E (BLAST). Il permet \u00e0 quiconque de comparer les s\u00e9quences de nucl\u00e9otides publi\u00e9es avec toutes celles stock\u00e9es par la base de donn\u00e9es g\u00e9n\u00e9tiques des National Institutes of Health (NIH) am\u00e9ricains appel\u00e9e GenBank. Nous pouvons donc BLASTER les amorces, les sondes et les s\u00e9quences de g\u00e8nes cibles revendiqu\u00e9es pour le SRAS-CoV-2.\u003C\/p\u003E\u003Cp\u003ELes protocoles de l'OMS concernant les amorces et les sondes avant et arri\u00e8re, pour le g\u00e9nome viral pr\u00e9sum\u00e9 du SRAS-CoV-2, sont bas\u00e9s sur les profils des g\u00e8nes RdRp, Orf1, N et E. N'importe qui peut les passer dans BLAST pour voir ce que nous trouvons.\u003C\/p\u003E\u003Cp\u003ELa s\u00e9quence nucl\u00e9otidique RdRP vitale, utilis\u00e9e comme amorce avant, est - ATGAGCTTAGTCCTGTTG. Si nous passons un nucl\u00e9otide dans BLAST, il est enregistr\u00e9 comme un isolat complet du SRAS-CoV-2 avec une identit\u00e9 de s\u00e9quence correspondant \u00e0 100%. De m\u00eame, la s\u00e9quence d'amorce du g\u00e8ne E arri\u00e8re - ATATTGCAGCAGTACGCACACA - r\u00e9v\u00e8le la pr\u00e9sence de la s\u00e9quence Orf1ab qui identifie \u00e9galement le SRAS-CoV-2.\u003C\/p\u003E\u003Cp\u003ECependant, BLAST nous permet \u00e9galement de rechercher les s\u00e9quences de nucl\u00e9otides des g\u00e9nomes microbiens et humains. Si nous recherchons la s\u00e9quence RdRp du SRAS-CoV-2, elle r\u00e9v\u00e8le 99 chromosomes humains avec une identit\u00e9 de s\u00e9quence de 100%. L'Orf1ab (g\u00e8ne E) en renvoie 90 avec une identit\u00e9 de s\u00e9quence de 100% avec les chromosomes humains.\u003C\/p\u003E\u003Cp\u003EEn faisant de m\u00eame pour ces s\u00e9quences avec une recherche microbienne, on trouve 92 microbes avec une correspondance de 100% au g\u00e8ne E du SRAS-CoV-2 et 100 microbes avec une identit\u00e9 de s\u00e9quence de 100% au g\u00e8ne vital RdRp du SRAS-CoV-2.\u003C\/p\u003E\u003Cp\u003EChaque fois que nous v\u00e9rifions les marqueurs g\u00e9n\u00e9tiques uniques du SRAS-CoV-2, enregistr\u00e9s dans les protocoles de l'OMS, nous trouvons des correspondances compl\u00e8tes ou \u00e0 pourcentage \u00e9lev\u00e9 avec divers fragments du g\u00e9nome humain. Cela sugg\u00e8re que les s\u00e9quences g\u00e9n\u00e9tiques, qui sont cens\u00e9es identifier le SRAS-CoV-2, ne sont pas uniques. Elles pourraient \u00eatre n'importe quoi, des s\u00e9quences microbiennes aux fragments de chromosomes humains.\u003C\/p\u003E\u003Cp\u003ELes soi-disant \u003Ca href=\"https:\/\/in-this-together.com\/not-fact-checkers\"\u003Ev\u00e9rificateurs de faits\u003C\/a\u003E, comme le projet Health Feedback de \u003Ci\u003EReuters\u003C\/i\u003E, se sont empress\u00e9s de rejeter les affirmations de \u003Ca href=\"http:\/\/philosophers-stone.info\/wp-content\/uploads\/2020\/11\/The-scam-has-been-confirmed-Dsalud-November-2020.pdf\" target=\"_blank\"\u003Eceux qui ont remarqu\u00e9\u003C\/a\u003E le manque apparent de sp\u00e9cificit\u00e9 du suppos\u00e9 g\u00e9nome du SRAS-CoV-2.\u003C\/p\u003E\u003Cp\u003EEn utilisant une s\u00e9rie d'arguments de paillasson comme \u00ab cette affirmation sugg\u00e8re que chaque test devrait \u00eatre positif \u00bb (ce qui n'est pas le cas), leur tentative de d\u00e9mystification \u003Ca href=\"https:\/\/healthfeedback.org\/claimreview\/human-dna-alone-does-not-produce-a-positive-result-on-the-rt-pcr-test-for-sars-cov-2\"\u003Eaboutit \u00e0 quelque chose comme cela\u003C\/a\u003E :\u003C\/p\u003E\u003Cp\u003E\u00ab Les amorces sont con\u00e7ues pour se lier \u00e0 des s\u00e9quences de nucl\u00e9otides sp\u00e9cifiques qui sont uniques au virus. L'amorce avant peut se lier \u00e0 un chromosome particulier, mais l'amorce arri\u00e8re ne se lie pas au m\u00eame chromosome et le chromosome n'est donc pas pr\u00e9sent dans le virus SRAS-CoV-2. En outre, comme les amorces avant et arri\u00e8re enveloppent la s\u00e9quence \u00e0 amplifier, la s\u00e9quence cDMA entre les amorces est unique au virus.\u003C\/p\u003E\u003Cp\u003ECela semble d\u00e9former d\u00e9lib\u00e9r\u00e9ment la signification de ces r\u00e9sultats en avan\u00e7ant un argument que personne, \u00e0 part les v\u00e9rificateurs de faits eux-m\u00eames, ne fait valoir. Les recherches men\u00e9es par BLAST montrent que ces s\u00e9quences cibles ne sont pas uniques au SRAS-CoV-2. Il n'est pas non plus n\u00e9cessaire de trouver toutes les cibles pour qu'un r\u00e9sultat soit jug\u00e9 positif.\u003C\/p\u003E\u003Cp\u003EDes chercheurs marocains ont \u003Ca href=\"https:\/\/www.medrxiv.org\/content\/10.1101\/2020.06.18.20135137v1\"\u003E\u00e9tudi\u00e9 l'\u00e9pid\u00e9miologie\u003C\/a\u003E des cas marocains pr\u00e9sum\u00e9s de SRAS-CoV-2. 9% des cas \u00e9taient positifs pour trois g\u00e8nes, 18% pour deux g\u00e8nes et 73% pour un seul. Comme nous venons de l'\u00e9voquer, beaucoup d'entre eux n'\u00e9taient peut-\u00eatre positifs pour aucun.\u003C\/p\u003E\u003Cp\u003ECela est tout \u00e0 fait conforme aux \u003Ca href=\"https:\/\/in-this-together.com\/Exg7jDe\/WHO-LTG20.pdf?x56485\" target=\"_blank\"\u003Edirectives de l'OMS\u003C\/a\u003E en mati\u00e8re de tests. Elles stipulent que :\u003C\/p\u003E\u003Cp\u003E\u00ab Un diagnostic optimal consiste en un test d'amplification de l'acide nucl\u00e9ique (NAAT) avec au moins deux cibles ind\u00e9pendantes du g\u00e9nome du SRAS-CoV-2 ; cependant, dans les zones o\u00f9 la transmission est r\u00e9pandue, un simple algorithme \u00e0 cible unique peut \u00eatre utilis\u00e9 (...). Un ou plusieurs r\u00e9sultats n\u00e9gatifs n'excluent pas n\u00e9cessairement l'infection par le SRAS-CoV-2 \u00bb.\u003C\/p\u003E\u003Cp\u003EL'argument selon lequel la RT-PCR ne trouve que de l'ARN est fallacieux. La transcription naturelle (la s\u00e9paration des brins d'ADN) se produit pendant l'expression des g\u00e8nes. Personne ne dit que des chromosomes ou des microbes entiers sont s\u00e9quenc\u00e9s dans le pr\u00e9tendu g\u00e9nome du SRAS-CoV-2. Quoiqu'il en soit, pour autant que nous sachions. Ils disent que les pr\u00e9tendus marqueurs, utilis\u00e9s pour tester ce suppos\u00e9 virus, ne sont pas adapt\u00e9s \u00e0 l'objectif.\u003C\/p\u003E\u003Cimg src=\"http:\/\/newsnet.fr\/\/img\/newsnet_181930_348909.jpg\" \/\u003E\u003Cp\u003ELes tests RT-PCR ne s\u00e9quencent pas l'int\u00e9gralit\u00e9 du g\u00e9nome. Ils recherchent des incidents de floraison de sondes sp\u00e9cifiques pour indiquer la pr\u00e9sence de s\u00e9quences dites existantes. Ces s\u00e9quences sont d\u00e9finies par MN908947.1 et les mises \u00e0 jour ult\u00e9rieures. Ces amorces et ces sondes ne peuvent r\u00e9v\u00e9ler que des correspondances d'ARN extraites d'ADN non codant, parfois appel\u00e9 \u00ab junk \u00bb (ADNc).\u003C\/p\u003E\u003Cp\u003EPar exemple, le \u003Ca href=\"https:\/\/www.genetex.com\/MarketingMaterial\/Index\/SARS-CoV-2_Genome_and_Proteome\"\u003Eg\u00e8ne S du SRAS-CoV-2\u003C\/a\u003E est cens\u00e9 \u00eatre hautement sp\u00e9cifique au g\u00e9nome du virus SRAS-CoV-2. La s\u00e9quence cible est - TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de s\u00e9quence d'identit\u00e9 de 100%. Le pourcentage de concordance le plus faible, parmi les 100 premiers, est de 95%. Une recherche BLAST sur le g\u00e9nome humain trouve \u00e9galement une correspondance de s\u00e9quence de 100% avec 86 fragments de chromosomes humains.\u003C\/p\u003E\u003Cp\u003EPeu importe o\u00f9 vous regardez dans le g\u00e9nome suppos\u00e9 du SRAS-CoV-2, il n'y a rien dans les protocoles de test de l'OMS qui identifie clairement de quoi il s'agit. L'ensemble du g\u00e9nome pourrait \u00eatre faux. Les tests ne prouvent pas l'existence du SRAS-CoV-2. Tout ce qu'ils r\u00e9v\u00e8lent, c'est une soupe de mat\u00e9riel g\u00e9n\u00e9tique non sp\u00e9cifi\u00e9.\u003C\/p\u003E\u003Cp\u003ESi tel est le cas, comme il n'y a pas d'isolats ou d'\u00e9chantillons purifi\u00e9s du virus, sans test viable, il n'y a aucune preuve de l'existence du SRAS-CoV-2. Par cons\u00e9quent, il n'y a pas non plus de preuve de l'existence d'une maladie appel\u00e9e COVID-19.\u003C\/p\u003E\u003Cp\u003ECela signifie qu'il n'y a pas de base scientifique pour toute affirmation concernant le nombre de cas de COVID-19, les admissions \u00e0 l'h\u00f4pital ou les chiffres de mortalit\u00e9. Toutes les mesures prises pour lutter contre ce virus mortel ne sont probablement fond\u00e9es sur rien.\u003C\/p\u003E\u003Cp\u003E\u003Cb\u003EFraude concluante\u003C\/b\u003E\u003C\/p\u003E\u003Cp\u003ELa fraude est un acte criminel. La \u003Ca href=\"https:\/\/thelawdictionary.org\/fraud\"\u003Ed\u00e9finition l\u00e9gale\u003C\/a\u003E de la fraude est la suivante :\u003C\/p\u003E\u003Cp\u003E\u00ab Une pratique trompeuse ou une manœuvre d\u00e9lib\u00e9r\u00e9e, \u00e0 laquelle on a recours dans l'intention de priver un tiers de son droit, ou de lui causer un pr\u00e9judice d'une mani\u00e8re ou d'une autre \u00bb.\u003C\/p\u003E\u003Cp\u003ELa d\u00e9finition l\u00e9gale d'une conspiration est la suivante :\u003C\/p\u003E\u003Cp\u003E\u00ab Une combinaison ou une conf\u00e9d\u00e9ration entre deux ou plusieurs personnes form\u00e9e dans le but de commettre, par leurs efforts conjoints, un acte ill\u00e9gal ou criminel \u00bb.\u003C\/p\u003E\u003Cp\u003EIl semble que ceux qui pr\u00e9tendent que nous sommes confront\u00e9s \u00e0 une pand\u00e9mie n'ont pas fourni de preuves montrant qu'un virus appel\u00e9 SRAS-CoV-2 provoque une maladie appel\u00e9e COVID-19. Toutes les informations sugg\u00e9rant fortement cette possibilit\u00e9 sont facilement disponibles dans le domaine public. Tout le monde peut les lire.\u003C\/p\u003E\u003Cp\u003EPour qu'il y ait fraude, la tromperie doit \u00eatre d\u00e9lib\u00e9r\u00e9e. L'intention doit \u00eatre de priver d\u00e9lib\u00e9r\u00e9ment d'autres personnes de leurs droits ou de leur porter pr\u00e9judice d'une mani\u00e8re ou d'une autre. S'il existe des preuves de collusion entre des individus et\/ou des organisations pour commettre une fraude, il s'agit alors d'une conspiration (dans les juridictions de droit commun) ou d'une \u003Ca href=\"https:\/\/www.oxfordbibliographies.com\/view\/document\/obo-9780199796953\/obo-9780199796953-0096.xml\"\u003EEntreprise Criminelle Commune\u003C\/a\u003E (ECC) en vertu du droit international.\u003C\/p\u003E\u003Cp\u003EIl semble que la COVID-19 ait \u00e9t\u00e9 d\u00e9lib\u00e9r\u00e9ment utilis\u00e9e comme casus belli pour faire la guerre \u00e0 l'humanit\u00e9. Nous avons \u00e9t\u00e9 emprisonn\u00e9s dans nos propres maisons, notre libert\u00e9 de circuler a \u00e9t\u00e9 restreinte, la libert\u00e9 de parole et d'expression a \u00e9t\u00e9 \u00e9rod\u00e9e, le droit de protester a \u00e9t\u00e9 r\u00e9duit, nous avons \u00e9t\u00e9 s\u00e9par\u00e9s de nos proches, nos entreprises ont \u00e9t\u00e9 d\u00e9truites, nous avons \u00e9t\u00e9 bombard\u00e9s psychologiquement, musel\u00e9s et terroris\u00e9s.\u003C\/p\u003E\u003Cp\u003EPire encore, alors qu'il n'existe \u003Ca href=\"http:\/\/inproportion2.talkigy.com\"\u003Eaucune preuve\u003C\/a\u003E que la mortalit\u00e9 toutes causes confondues soit sans pr\u00e9c\u00e9dent, il y a eu des pics de mortalit\u00e9 hors saison. Ces chiffres \u003Ca href=\"https:\/\/www.ukcolumn.org\/article\/lockdown-deaths-not-covid-deaths\"\u003Ecorrespondent pr\u00e9cis\u00e9ment aux mesures de \u00ab confinement \u00bb\u003C\/a\u003E qui ont vu le retrait des services de sant\u00e9 que nous payons et une r\u00e9orientation des services de sant\u00e9 publique pour traiter une maladie pr\u00e9sum\u00e9e \u00e0 l'exclusion de toutes les autres.\u003C\/p\u003E\u003Cp\u003EEn outre, ceux qui ont transmis l'histoire de la COVID-19 proposent que cette maladie pr\u00e9sum\u00e9e justifie la restructuration compl\u00e8te de l'\u00e9conomie mondiale, de nos syst\u00e8mes politiques, de nos soci\u00e9t\u00e9s, de nos cultures et de \u003Ca href=\"https:\/\/winteroak.org.uk\/2020\/10\/05\/klaus-schwab-and-his-great-fascist-reset\"\u003El'humanit\u00e9 elle-m\u00eame\u003C\/a\u003E.\u003C\/p\u003E\u003Cp\u003EPour \u00eatre autoris\u00e9s \u00e0 participer \u00e0 ce qu'on appelle leur \u00ab nouvelle normalit\u00e9 \u00bb, qui est la transformation compl\u00e8te de toute notre soci\u00e9t\u00e9 sans notre consentement, ils insistent pour que nous nous soumettions \u00e0 leurs conditions.\u003C\/p\u003E\u003Cp\u003ECelles-ci comprennent, sans s'y limiter, la surveillance biom\u00e9trique de chacun, le contr\u00f4le et la surveillance centralis\u00e9s de toutes nos transactions, des restrictions commerciales et sociales oppressives et une demande effective que nous n'ayons pas droit \u00e0 la souverainet\u00e9 sur nos propres corps. Ceci constitue la condition de l'esclavage.\u003C\/p\u003E\u003Cp\u003EIl ne fait aucun doute que nous avons \u00e9t\u00e9 priv\u00e9s de nos droits et bless\u00e9s. Dans les juridictions de droit commun, l'innocence est pr\u00e9sum\u00e9e, mais les preuves qu'un pr\u00e9judice a \u00e9t\u00e9 d\u00e9lib\u00e9r\u00e9ment caus\u00e9 par une conspiration internationale sont accablantes. Les politiques destructrices, adopt\u00e9es par les gouvernements du monde entier, ont clairement trouv\u00e9 leur origine dans les groupes de r\u00e9flexion mondialistes et les institutions supranationales bien avant l'\u00e9mergence de cette pand\u00e9mie inexistante.\u003C\/p\u003E\u003Cp\u003EDans les juridictions du Code Napol\u00e9on, la culpabilit\u00e9 est pr\u00e9sum\u00e9e. Pour que les conspirateurs accus\u00e9s puissent prouver leur innocence, ils doivent montrer que, malgr\u00e9 leurs ressources incommensurables, ils ont \u00e9t\u00e9 collectivement incapables d'acc\u00e9der ou de comprendre les preuves librement disponibles sugg\u00e9rant que la COVID-19 est un mythe.\u003C\/p\u003E\u003Cp\u003ELes responsables du crime de conspiration en vue de commettre une fraude mondiale doivent \u00eatre jug\u00e9s. S'ils sont reconnus coupables, ils devraient \u00eatre emprisonn\u00e9s pendant que le reste d'entre nous s'efforce de r\u00e9parer les dommages qu'ils ont d\u00e9j\u00e0 caus\u00e9s.\u003C\/p\u003E\u003Cp\u003Esource : \u003Ca href=\"https:\/\/off-guardian.org\/2020\/11\/17\/covid19-evidence-of-global-fraud\"\u003Eoff-guardian.org\u003C\/a\u003E\u003C\/p\u003E\u003Cp\u003Etraduit par \u003Ca href=\"https:\/\/reseauinternational.net\"\u003ER\u00e9seau International\u003C\/a\u003E\u003C\/p\u003E\u003Cp\u003E\u003Ca href=\"http:\/\/reseauinternational.net\/covid-19-preuves-de-fraude-mondiale\/\"\u003Ereseauinternational.net\u003C\/a\u003E\u003C\/p\u003E"}}