21/11/2020 reseauinternational.net  22 min #181930

Covid-19 - Preuves de fraude mondiale

par Iain Davis.

La COVID-19, et les réponses gouvernementales subséquentes, semblent faire partie d'une conspiration internationale visant à commettre des fraudes. Il semble qu'il n'y ait aucune preuve qu'un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19.

Parfois, il faut suivre son instinct. Je ne suis pas un expert en génétique et, comme toujours, je suis susceptible d'être corrigé. Toutefois, mon attention a été attirée par certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery.  Leur conseil consultatif composé de médecins et de scientifiques éminemment qualifiés confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les amorces et les sondes génétiques utilisées dans les tests RT-PCR pour identifier le SRAS-CoV-2 ne ciblent rien de spécifique. J'ai suivi les techniques de recherche décrites dans cette traduction anglaise de leur rapport et je peux corroborer l'exactitude de leurs affirmations concernant les séquences de nucléotides énumérées dans les protocoles de l'Organisation Mondiale de la Santé. Vous pouvez faire de même.

D-Salud-Discovery déclare qu'il n'existe pas de tests capables d'identifier le SRAS-CoV-2. Par conséquent, toutes les allégations concernant l'impact présumé de la COVID-19 sur la santé de la population sont sans fondement.

L'ensemble du récit officiel de la COVID-19 est une tromperie. Apparemment, il n'y a aucun fondement scientifique pour aucune partie de ce récit.

Si ces affirmations sont exactes, nous pouvons affirmer qu'il n'y a aucune preuve de pandémie, mais seulement l'illusion d'une pandémie. Nous avons subi des pertes incalculables sans raison évidente, si ce n'est les ambitions de despotes sans scrupules qui souhaitent transformer l'économie mondiale et notre société pour répondre à leurs objectifs.

Ce faisant, cette « classe de parasites » a potentiellement commis d'innombrables crimes. Ces crimes peuvent et doivent faire l'objet d'une enquête et de poursuites devant un tribunal.

Identification de quoi exactement ?

L'Organisation Mondiale de la Santé (OMS) a  classifié la maladie COVID-19 (COronaVIrus Disease 2019). Elle a déclaré une pandémie mondiale de COVID-19 le 11 mars 2019.

Le guide de l'OMS sur les essais en laboratoire stipule ce qui suit :

« L'agent étiologique [causalité de la maladie] responsable de l'ensemble des cas de pneumonie à Wuhan a été identifié comme un nouveau betacoronavirus (de la même famille que le SRAS-CoV et le MERS-CoV) par séquençage de nouvelle génération (NGS) à partir de virus cultivés ou directement à partir d'échantillons reçus de plusieurs patients atteints de pneumonie ».

L'OMS affirme que le virus SRAS-CoV-2 est à l'origine de la maladie appelée COVID-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de l'OMS intitulé «  Nouveau Coronavirus 2019-nCov Rapport de Situation 1 », ils affirment :

« Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020... Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays puissent l'utiliser dans le développement de kits de diagnostic spécifiques ».

Ces deux déclarations de l'OMS suggèrent clairement que le virus SRAS-CoV-2 a été isolé (c'est-à-dire purifié pour être étudié) et que des séquences génétiques ont ensuite été identifiées à partir de l'échantillon isolé. À partir de là, des kits de diagnostic ont été mis au point et distribués dans le monde entier pour tester le virus dans les villes et les communautés du monde entier. Selon l'OMS et les chercheurs chinois, ces tests permettront de trouver le virus qui cause la COVID-19.

Pourtant, l'OMS déclare également :

« Travaillant directement à partir des informations sur les séquences, l'équipe a mis au point une série de tests d'amplification génétique (PCR) utilisés par les laboratoires ».

Les scientifiques de Wuhan ont développé leurs tests d'amplification génétique à partir des « informations sur les séquences » parce qu'il n'y avait pas d'échantillon isolé et purifié du fameux virus SRAS-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines avec des pics contenant l'ARN viral).

Toutefois, ces structures protéiques ne sont  pas uniques. Elles ressemblent à d'autres vésicules rondes, telles que les vésicules endocytiques et les exosomes.

Les virologistes affirment qu'il n'est pas possible « d'isoler » un virus parce qu'il ne se réplique qu'à l'intérieur des cellules hôtes. Ils ajoutent que les  postulats de Koch ne s'appliquent pas parce qu'ils concernent les bactéries (qui sont des organismes vivants). Les virologistes observent plutôt les effets cytopathogènes (ECP) du virus, qui provoquent la mutation et la dégradation des cellules, dans des cultures cellulaires.

Lorsque les chercheurs chinois ont  séquencé le génome complet du SRAS-CoV-2 pour la première fois, ils ont observé des ECP dans les cellules Vero E6 et Huh7. Les Vero E6 sont une lignée cellulaire immortalisée de singe et les Huh7 sont des cellules cancéreuses (tumorigènes) immortalisées. Cela signifie qu'elles ont été maintenues in vitro (dans des cultures en boîte de Pétri) pendant de nombreuses années.

Au cœur de l'histoire officielle du SRAS-CoV-2 se trouve l'idée qu'il s'agit d'un virus zoonotique, capable de passer de l'animal à l'homme. Lorsque les scientifiques du CDC américain ont « infecté » diverses cellules avec le nouveau virus, ils ont constaté ce qui suit :

« Nous avons examiné la capacité du SRAS-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires communes de primates et d'humains, notamment les cellules d'adénocarcinome humain (A549) [celles des poumons], les cellules de foie humain (HUH7. 0) et des cellules rénales embryonnaires humaines (HEK-293T), en plus des cellules Vero E6 et Vero CCL81 [cellules de singe]... Aucun effet cytopathique n'a été observé dans aucune des lignées cellulaires, sauf dans les cellules Vero [cellules de singe]... Les cellules HUH7.0 et 293T n'ont montré qu'une réplication virale modeste et les cellules A549 [cellules de tissu pulmonaire humain] étaient incompatibles avec l'infection par le SRAS-CoV-2 ».

Le CDC n'a observé aucun ECP dans les cellules humaines. Ils n'ont vu aucune preuve que ce prétendu virus ait causé une quelconque maladie humaine. Ce supposé virus humain n'a pas non plus montré de réplication notable dans les cellules humaines, ce qui suggère qu'une infection d'homme à homme serait impossible.

Constatant ce problème, une équipe de scientifiques polonais a introduit ce « virus » séquencé dans des cellules d'épithélium humain (voies aériennes). Ils ont observé les effets sur ces cultures d'épithélium humain pendant 5 jours. Ils ont noté une réplication beaucoup plus importante que les scientifiques du CDC, mais ont finalement déclaré :

« Nous n'avons observé aucune libération du virus du côté basolatéral de la culture d'épithélium humain ».

Ce qui signifie qu'ils n'ont vu aucune preuve que les virions supposés aient rompu la membrane de la paroi cellulaire. Ce qui suggère à nouveau que ce soi-disant virus n'est pas infectieux chez les êtres humains.

Il n'est pas certain que le SRAS-CoV-2 soit un virus humain capable de provoquer une maladie. Il se peut même qu'il n'existe pas physiquement. N'est-ce rien d'autre qu'un concept basé sur des séquences génétiques prédictives ?

Voyage de Discovery

Le Centre de Contrôle et de Prévention des Maladies de Wuhan et le Centre Clinique de Santé Publique de Shanghai ont publié le  premier génome complet du SRAS-CoV-2 (MN908947.1). Celui-ci a été mis à jour à de nombreuses reprises. Cependant, MN908947.1 a été la première séquence génétique décrivant le prétendu agent étiologique de la COVID-19 (SARS-CoV-2).

Toutes les revendications, tests, traitements, statistiques, développement de vaccins et politiques qui en découlent sont basés sur cette séquence. Si les tests de ce nouveau virus n'identifient rien qui puisse causer une maladie chez les êtres humains, tout le récit de la COVID-19 n'est qu'une mascarade.

Les chercheurs de Wuhan ont  déclaré qu'ils avaient efficacement reconstitué la séquence génétique du SRAS-CoV-2 en faisant correspondre des fragments trouvés dans des échantillons avec d'autres séquences génétiques découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1% avec le coronavirus du SRAS (SARS-Cov). Ils ont utilisé  l'assemblage de novo et le PCR ciblé et ont trouvé 29 891 paires de bases qui partageaient une séquence correspondant à 79,6% au SRAS-CoV.

Ils ont dû utiliser l'assemblage de novo parce qu'ils n'avaient aucune connaissance a priori de la séquence ou de l'ordre corrects de ces fragments. Tout simplement, la déclaration de l'OMS selon laquelle les chercheurs chinois ont isolé le virus le 7 janvier est fausse.

L'équipe de Wuhan a utilisé 40 cycles d'amplification RT-qPCR pour faire correspondre des fragments d'ADNc (ADN complémentaire construit à partir de fragments d'ARN échantillonnés) avec le génome publié du coronavirus du SRAS (SARS-CoV). Malheureusement, la précision du génome original du coronavirus du SRAS n'est pas claire non plus.

En 2003, une équipe de  chercheurs de Hong Kong a étudié 50 patients atteints du Syndrome Respiratoire Aigu Sévère (SRAS). Ils ont prélevé des échantillons sur 2 de ces patients et ont développé une culture dans des cellules de foie de singe fœtal.

Ils ont créé 30 clones du matériel génétique qu'ils ont trouvé. Incapables de trouver des preuves d'un autre virus connu, ils ont trouvé dans un seul de ces échantillons clonés des séquences génétiques « d'origine inconnue ».

En examinant ces séquences d'ARN inconnues, ils ont trouvé 57% de correspondance avec le coronavirus bovin et le virus de l'hépatite murine et en ont déduit qu'il était de la famille des Coronaviridae. Considérant que ces séquences suggèrent un virus du SRAS-CoV récemment découvert (les nouvelles découvertes étant l'ambroisie pour les scientifiques), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré :

« Les amorces pour la détection du nouveau virus ont été conçues pour la détection par RT-PCR du génome de ce coronavirus associé à la pneumonie humaine dans des échantillons cliniques. Sur les 44 échantillons nasopharyngés disponibles provenant des 50 patients atteints du SRAS, 22 présentaient des traces d'ARN de coronavirus humain associé à la pneumonie ».

La moitié des patients testés, qui présentaient tous les mêmes symptômes, se sont révélés positifs pour ce nouveau virus présumé. Personne ne sait pourquoi l'autre moitié a été testée négative pour ce nouveau virus du SRAS-CoV. La question n'a pas été posée.

Ce prétendu virus n'avait qu'une séquence correspondant à 57% à un coronavirus prétendument connu. Les 43% restants étaient juste « là ». Les données séquencées ont été produites et enregistrées comme un nouveau génome sous le numéro d'accession à la GenBank AY274119.

Les chercheurs de Wuhan ont ensuite trouvé une correspondance de séquence de 79,6% avec AY274119 et l'ont donc appelée une nouvelle souche de SRAS-CoV (2019-nCoV - finalement rebaptisée SARS-CoV-2). À aucun moment de ce processus, personne n'avait produit d'échantillon isolé et purifié d'un quelconque virus. Tout ce qu'ils avaient, c'était des pourcentages de concordance de séquences avec d'autres pourcentages de concordance de séquences.

Isoler rien

Les scientifiques sont très ennuyés parce qu'ils n'arrêtent pas de dire que le virus a été isolé mais que personne ne les croit. C'est parce que, jusqu'à présent, personne n'a fourni un seul échantillon purifié du virus SRAS-CoV-2. Ce que nous avons à la place, c'est un génome complet et, comme nous sommes sur le point de le découvrir, ce n'est pas particulièrement convaincant.

Les journalistes d'investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images des virions du SRAS-CoV-2 de confirmer qu'il s'agissait bien d'images d'un virus isolé et purifié.  Aucun d'entre eux n'a pu le faire.

En Australie, des scientifiques de  l'Institut Doherty ont annoncé qu'ils avaient  isolé le virus SRAS-CoV-2. Lorsqu'on leur a demandé de préciser, les scientifiques ont déclaré :

« Nous avons de courtes séquences (ARN) provenant du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic ».

Cela explique pourquoi le  gouvernement australien déclare :

« La fiabilité des tests de la COVID-19 est incertaine en raison du peu de preuves disponibles... Il existe peu de preuves pour évaluer la précision et l'utilité clinique des tests de la COVID-19 disponibles ».

Au Royaume-Uni, en juillet, un groupe d'universitaires inquiets a  écrit une lettre au Premier Ministre britannique Boris Johnson dans laquelle ils lui demandent de :

« Produire des preuves scientifiques indépendantes, examinées par des pairs, prouvant que le virus de la COVID-19 a été isolé ».

À ce jour, ils n'ont pas reçu de réponse.

De même, le chercheur britannique  Andrew Johnson a adressé une requête en vertu de la Liberté d'Information à Public Health England (PHE). Il leur a demandé de lui fournir leurs dossiers décrivant l'isolement d'un virus SRAS-COV-2. Ce à quoi ils ont répondu :

« PHE peut confirmer qu'il ne détient pas d'informations de la manière suggérée par votre demande ».

La chercheuse canadienne Christine Massey a fait une demande d'accès à l'information similaire, demandant la même chose au gouvernement canadien. Ce à quoi le gouvernement canadien a répondu :

« Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n'avons pu trouver aucun document répondant à votre demande ».

Aux États-Unis, le  panel de diagnostic RT-PCR du CDC indique :

«... Aucun isolat quantifié du virus 2019-nCoV n'est actuellement disponible... La détection de l'ARN viral peut ne pas indiquer la présence d'un virus infectieux ou que le 2019-nCoV est l'agent responsable des symptômes cliniques ».

Dernière mise à jour le 13 juillet 2020, les CDC n'ont pas encore obtenu d'échantillon viral pur d'un patient dit atteint de la maladie de la COVID-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le SRAS-CoV-2 est présent ou cause la COVID-19.

On nous dit que rien de tout cela n'a d'importance. Que nous sommes ignorants et que nous ne comprenons tout simplement pas la virologie. Par conséquent, nous devons accepter des images de choses dont nous savons qu'elles pourraient être autre chose et des séquences génétiques (qui pourraient être n'importe quoi d'autre) comme preuve concluante que ce virus, et la maladie qu'il est censé causer, sont réels.

Des tests pour rien

L'OMS, ainsi que tous les gouvernements, les groupes de réflexion, les comités directeurs, les conseillers scientifiques gouvernementaux, les institutions supranationales et autres qui font la promotion de l'exposé officiel de la COVID-19, affirment que le SRAS-CoV-2 provoque la COVID-19.

Alors que personne n'a jamais produit d'échantillon de ce supposé virus, le prétendu génome du SRAS-CoV-2 a  été publié. Il est dans le domaine public.

Des  séquences génétiques clés, dans le génome du SRAS-CoV-2, auraient des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour identifier la présence du « virus ». Il s'agit notamment de :

  • Le gène de l'ARN-polymérase (Rd-Rp) - Il permet à l'ARN du SRAS-CoV-2 de se répliquer dans le cytoplasme des cellules épithéliales malades de la COVID-19.
  • Le gène S (Orf2) - cette glycoprotéine forme le pic à la surface du virion du SRAS-CoV-2 qui est censé faciliter la liaison du SRAS-CoV-2 aux récepteurs ACE2 des cellules, permettant à l'ARN situé à l'intérieur de l'enveloppe protéique du virion (capside) de passer dans la cellule désormais infectée.
  • Le Gène E (Orf1ab) - petite protéine membranaire utilisée dans l'assemblage du virus.
  • Le Gène N (Orf9a) - le gène de la nucléocapside qui se lie à l'ARN lors de la formation de la capside.

L'OMS tient un registre public des amorces et des sondes RT-PCR utilisées pour tester le SRAS-CoV-2. Les amorces sont des séquences de nucléotides spécifiques qui se lient (s'annulent) aux brins antisens et sensoriels de l'ADNc synthétisé (appelées respectivement amorces avant et arrière).

Les brins d'ADNc se séparent lorsqu'ils sont chauffés et se reforment lorsqu'ils sont refroidis. Avant le refroidissement, des séquences de nucléotides appelées sondes sont introduites pour s'hybrider à des régions cibles spécifiques du génome viral suspecté. Au cours de l'amplification, lorsque les régions entre les amorces s'allongent, lorsqu'une amorce frappe une sonde, celle-ci se désintègre en libérant un fluorescent ou un colorant qui peut alors être lu par les chercheurs.

C'est l'identification de ces marqueurs que les scientifiques prétendent prouver la présence du SRAS-CoV-2 dans un échantillon.

Un autre outil accessible au public est le  Basic Local Alignment Search Tool (BLAST). Il permet à quiconque de comparer les séquences de nucléotides publiées avec toutes celles stockées par la base de données génétiques des National Institutes of Health (NIH) américains appelée GenBank. Nous pouvons donc BLASTER les amorces, les sondes et les séquences de gènes cibles revendiquées pour le SRAS-CoV-2.

Les protocoles de l'OMS concernant les amorces et les sondes avant et arrière, pour le génome viral présumé du SRAS-CoV-2, sont basés sur les profils des gènes RdRp, Orf1, N et E. N'importe qui peut les passer dans BLAST pour voir ce que nous trouvons.

La séquence nucléotidique RdRP vitale, utilisée comme amorce avant, est - ATGAGCTTAGTCCTGTTG. Si nous passons un nucléotide dans BLAST, il est enregistré comme un isolat complet du SRAS-CoV-2 avec une identité de séquence correspondant à 100%. De même, la séquence d'amorce du gène E arrière - ATATTGCAGCAGTACGCACACA - révèle la présence de la séquence Orf1ab qui identifie également le SRAS-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences de nucléotides des génomes microbiens et humains. Si nous recherchons la séquence RdRp du SRAS-CoV-2, elle révèle 99 chromosomes humains avec une identité de séquence de 100%. L'Orf1ab (gène E) en renvoie 90 avec une identité de séquence de 100% avec les chromosomes humains.

En faisant de même pour ces séquences avec une recherche microbienne, on trouve 92 microbes avec une correspondance de 100% au gène E du SRAS-CoV-2 et 100 microbes avec une identité de séquence de 100% au gène vital RdRp du SRAS-CoV-2.

Chaque fois que nous vérifions les marqueurs génétiques uniques du SRAS-CoV-2, enregistrés dans les protocoles de l'OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, qui sont censées identifier le SRAS-CoV-2, ne sont pas uniques. Elles pourraient être n'importe quoi, des séquences microbiennes aux fragments de chromosomes humains.

Les soi-disant  vérificateurs de faits, comme le projet Health Feedback de Reuters, se sont empressés de rejeter les affirmations de ceux qui ont remarqué le manque apparent de spécificité du supposé génome du SRAS-CoV-2.

En utilisant une série d'arguments de paillasson comme « cette affirmation suggère que chaque test devrait être positif » (ce qui n'est pas le cas), leur tentative de démystification  aboutit à quelque chose comme cela :

« Les amorces sont conçues pour se lier à des séquences de nucléotides spécifiques qui sont uniques au virus. L'amorce avant peut se lier à un chromosome particulier, mais l'amorce arrière ne se lie pas au même chromosome et le chromosome n'est donc pas présent dans le virus SRAS-CoV-2. En outre, comme les amorces avant et arrière enveloppent la séquence à amplifier, la séquence cDMA entre les amorces est unique au virus.

Cela semble déformer délibérément la signification de ces résultats en avançant un argument que personne, à part les vérificateurs de faits eux-mêmes, ne fait valoir. Les recherches menées par BLAST montrent que ces séquences cibles ne sont pas uniques au SRAS-CoV-2. Il n'est pas non plus nécessaire de trouver toutes les cibles pour qu'un résultat soit jugé positif.

Des chercheurs marocains ont  étudié l'épidémiologie des cas marocains présumés de SRAS-CoV-2. 9% des cas étaient positifs pour trois gènes, 18% pour deux gènes et 73% pour un seul. Comme nous venons de l'évoquer, beaucoup d'entre eux n'étaient peut-être positifs pour aucun.

Cela est tout à fait conforme aux directives de l'OMS en matière de tests. Elles stipulent que :

« Un diagnostic optimal consiste en un test d'amplification de l'acide nucléique (NAAT) avec au moins deux cibles indépendantes du génome du SRAS-CoV-2 ; cependant, dans les zones où la transmission est répandue, un simple algorithme à cible unique peut être utilisé (...). Un ou plusieurs résultats négatifs n'excluent pas nécessairement l'infection par le SRAS-CoV-2 ».

L'argument selon lequel la RT-PCR ne trouve que de l'ARN est fallacieux. La transcription naturelle (la séparation des brins d'ADN) se produit pendant l'expression des gènes. Personne ne dit que des chromosomes ou des microbes entiers sont séquencés dans le prétendu génome du SRAS-CoV-2. Quoiqu'il en soit, pour autant que nous sachions. Ils disent que les prétendus marqueurs, utilisés pour tester ce supposé virus, ne sont pas adaptés à l'objectif.

Les tests RT-PCR ne séquencent pas l'intégralité du génome. Ils recherchent des incidents de floraison de sondes spécifiques pour indiquer la présence de séquences dites existantes. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et ces sondes ne peuvent révéler que des correspondances d'ARN extraites d'ADN non codant, parfois appelé « junk » (ADNc).

Par exemple, le  gène S du SRAS-CoV-2 est censé être hautement spécifique au génome du virus SRAS-CoV-2. La séquence cible est - TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d'identité de 100%. Le pourcentage de concordance le plus faible, parmi les 100 premiers, est de 95%. Une recherche BLAST sur le génome humain trouve également une correspondance de séquence de 100% avec 86 fragments de chromosomes humains.

Peu importe où vous regardez dans le génome supposé du SRAS-CoV-2, il n'y a rien dans les protocoles de test de l'OMS qui identifie clairement de quoi il s'agit. L'ensemble du génome pourrait être faux. Les tests ne prouvent pas l'existence du SRAS-CoV-2. Tout ce qu'ils révèlent, c'est une soupe de matériel génétique non spécifié.

Si tel est le cas, comme il n'y a pas d'isolats ou d'échantillons purifiés du virus, sans test viable, il n'y a aucune preuve de l'existence du SRAS-CoV-2. Par conséquent, il n'y a pas non plus de preuve de l'existence d'une maladie appelée COVID-19.

Cela signifie qu'il n'y a pas de base scientifique pour toute affirmation concernant le nombre de cas de COVID-19, les admissions à l'hôpital ou les chiffres de mortalité. Toutes les mesures prises pour lutter contre ce virus mortel ne sont probablement fondées sur rien.

Fraude concluante

La fraude est un acte criminel. La  définition légale de la fraude est la suivante :

« Une pratique trompeuse ou une manœuvre délibérée, à laquelle on a recours dans l'intention de priver un tiers de son droit, ou de lui causer un préjudice d'une manière ou d'une autre ».

La définition légale d'une conspiration est la suivante :

« Une combinaison ou une confédération entre deux ou plusieurs personnes formée dans le but de commettre, par leurs efforts conjoints, un acte illégal ou criminel ».

Il semble que ceux qui prétendent que nous sommes confrontés à une pandémie n'ont pas fourni de preuves montrant qu'un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19. Toutes les informations suggérant fortement cette possibilité sont facilement disponibles dans le domaine public. Tout le monde peut les lire.

Pour qu'il y ait fraude, la tromperie doit être délibérée. L'intention doit être de priver délibérément d'autres personnes de leurs droits ou de leur porter préjudice d'une manière ou d'une autre. S'il existe des preuves de collusion entre des individus et/ou des organisations pour commettre une fraude, il s'agit alors d'une conspiration (dans les juridictions de droit commun) ou d'une  Entreprise Criminelle Commune (ECC) en vertu du droit international.

Il semble que la COVID-19 ait été délibérément utilisée comme casus belli pour faire la guerre à l'humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté de circuler a été restreinte, la liberté de parole et d'expression a été érodée, le droit de protester a été réduit, nous avons été séparés de nos proches, nos entreprises ont été détruites, nous avons été bombardés psychologiquement, muselés et terrorisés.

Pire encore, alors qu'il n'existe  aucune preuve que la mortalité toutes causes confondues soit sans précédent, il y a eu des pics de mortalité hors saison. Ces chiffres  correspondent précisément aux mesures de « confinement » qui ont vu le retrait des services de santé que nous payons et une réorientation des services de santé publique pour traiter une maladie présumée à l'exclusion de toutes les autres.

En outre, ceux qui ont transmis l'histoire de la COVID-19 proposent que cette maladie présumée justifie la restructuration complète de l'économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de  l'humanité elle-même.

Pour être autorisés à participer à ce qu'on appelle leur « nouvelle normalité », qui est la transformation complète de toute notre société sans notre consentement, ils insistent pour que nous nous soumettions à leurs conditions.

Celles-ci comprennent, sans s'y limiter, la surveillance biométrique de chacun, le contrôle et la surveillance centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives et une demande effective que nous n'ayons pas droit à la souveraineté sur nos propres corps. Ceci constitue la condition de l'esclavage.

Il ne fait aucun doute que nous avons été privés de nos droits et blessés. Dans les juridictions de droit commun, l'innocence est présumée, mais les preuves qu'un préjudice a été délibérément causé par une conspiration internationale sont accablantes. Les politiques destructrices, adoptées par les gouvernements du monde entier, ont clairement trouvé leur origine dans les groupes de réflexion mondialistes et les institutions supranationales bien avant l'émergence de cette pandémie inexistante.

Dans les juridictions du Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils doivent montrer que, malgré leurs ressources incommensurables, ils ont été collectivement incapables d'accéder ou de comprendre les preuves librement disponibles suggérant que la COVID-19 est un mythe.

Les responsables du crime de conspiration en vue de commettre une fraude mondiale doivent être jugés. S'ils sont reconnus coupables, ils devraient être emprisonnés pendant que le reste d'entre nous s'efforce de réparer les dommages qu'ils ont déjà causés.

source :  off-guardian.org

traduit par  Réseau International

 reseauinternational.net

 Commenter